INNRØMMER MENNESKELIG FEIL: På grunn av menneskelig feil ved vårt DNA- laboratorium er en prøve av villsvin feilaktig rapportert som vanlig gris, skriver administrerende direktør Jon Ragnar Røed i Eurofins Food & Feed Testing Norway AS.

Debatt

Eurofins beklager: Alle analysene fra restaurant Skutebrygga er villsvin

Eurofins beklager at et analyseresultat i en av VG’s matjukssaker er rapportert feil.

Dette er en kronikk. Kronikken gir uttrykk for skribentens holdning. Du kan sende inn kronikker og debattinnlegg til VG her.

Artikkelen er over fire år gammel

Av: Jon Ragnar Røed, Administrerende direktør i Eurofins Food & Feed Testing Norway AS.

Eurofins beklager at et analyseresultat i en av VG’s matjukssaker er rapportert feil.

Vi har i møter med VG og restaurant Skutebrygga redegjort for at vi har analysert korrekt, men på grunn av menneskelig feil ved vårt DNA- laboratorium er en prøve av villsvin feilaktig rapportert som vanlig gris.

Eurofins Food & Feed Testing Norway AS har i flere omganger siden i november 2015 utført DNA-analyser av restaurantmat for VG.

Prøvene ble mottatt i godt merkede plastcontainere fra VG’s journalister, uten informasjon om hvor prøvene var tatt ut. Prøvene er videresend uåpnet til Eurofins Medigenomix i Ebersberg i Tyskland, som er Eurofins kompetansesenter og det største laboratoriet for denne type DNA-analyser i Europa.

«På grunn av menneskelig feil ved vårt DNA- laboratorium er en prøve av villsvin feilaktig rapportert som vanlig gris.»

DNA-analyser er en meget sikker måte å finne et produkts opprinnelse på. DNA er en unik merking som kan benyttes til å utlede og bestemme arter, samt avdekke variasjoner innenfor samme art. Så lenge det er biologisk materiale tilgjengelig i et produkt, kan man ved hjelp av DNA-metoder artsbestemme næringsmidler av animalsk eller vegetabilsk opprinnelse.

Eurofins kan ved hjelp av spesifikke rensemetoder og kombinasjon av ulike varianter av PCR (Polymerase Chain Reaction) og sekvensering detektere helt ned til noen få DNA-molekyler.

For å skille mellom vanlig gris (Sus scrofa domestica) og villsvin (Sus scrofa scrofa) er det analysert på fragmenter av Melanocortin Reseptor 1 (MCR1) funnet i mitokondriene til i cellene. Fragmentene er amplifiserte med en PCR metode, og deretter er det sekvensert de deler som skiller de ulike arter. Ved å sammenligne flere deler av disse genene kan man med sikkerhet skille mellom vanlig gris, hybrider (krysninger) og villsvin.

Eksempel på SNP (Single Nucleotide Polymorphism) med forskjell mellom vanlig gris og villsvin:

Domestic Pig AATGTCATGAACGTGCTCATCTGCGGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGCGCC

Wild Boar P. AAYRTCATGGAYGTGCTCATCTGCGGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGCGCC

*******.**************************************************

Alle prøvene i denne saken er analysert to ganger for ekstra sikkerhet.

Etter at saken ble publisert av VG leverte Skutebrygga inn nye prøver av villsvin for DNA-analyse. De stilte flere avanserte tekniske spørsmål knyttet til analysemetodikk for å skille mellom villsvin og vanlig gris. Disse spørsmålene ble sendt til DNA-laboratoriet i Tyskland som valgte å se på de opprinnelige prøvene på nytt.

Det ble da oppdaget at det var begått en menneskelig feil ved overføring fra analysert resultat til rapportert resultat for en av prøvene. På denne prøven var dobbeltanalysen utført direkte etter hverandre samme dag. Begge DNA-analysene viste at prøven var villsvin (Sus scrofa scrofa), men resultatet ble for begge prøvene på laboratoriet feilaktig overført til rapport som vanlig gris (Sus scrofa domestica). Dessverre ble denne overføringsfeilen heller ikke oppdaget i sluttkontrollen.

Alle prøvene som vårt DNA-laboratorium har mottatt fra VG i denne saken er gjennomgått på nytt og reanalysert for enda en ekstra kontroll. De opprinnelige resultatene fra alle de andre prøvene i saken kan med 100 % sikkerhet bekreftes.

Det er allerede iverksatt flere tiltak slik at feil i overføring av resultat til rapport ikke skal forekomme i fremtiden. Dobbeltprøver vil bli analysert på forskjellige dager, rapporteringsmalen blir endret slik at deler av den mest typiske DNA- sekvensen vil bli mer visuelt synlig, og dataene skal overføres automatisk til rapport med en ekstra kontroll.

«Vi beklager på det sterkeste denne feil ovenfor VG, Skutebrygga, deres underleverandører og alle andre berørte».

Eurofins har gjort en menneskelig feil ved rapporteringen av et resultat i denne saken. Vi beklager på det sterkeste denne feil ovenfor VG, Skutebrygga, deres underleverandører og alle andre berørte. Vi har gått igjennom sporbarhetsdokumentasjonen til Skutebrygga, og kan konstatere at de har en meget profesjonell og god kontroll på sine råvarer. Derfor er det veldig uheldig og trist at dette har gått ut over nettopp dem.

Flere artikler

  1. Matprøve var feil

  2. Pluss content

    VG beklager: Matprøve var feil

  3. Restaurantjukset: Mattilsynet vil gjennomføre tilsyn etter VG-avsløring

  4. Test av spa: Sæd i sauna og bakterier i boblebad

  5. VG AVSLØRER: Restaurant jukset med maten: Byttet ut eksklusive råvarer med billigere alternativer

Fra andre aviser

  1. OPCW: Nervegass er funnet på ofre etter angrep i Syria

    Aftenposten
  2. Norsk professor frykter at uskyldige blir tatt for doping i OL: – Ingen bryr seg

    Bergens Tidende
  3. Frode Thuen: - Noen har nok innrømmet utroskap

    Aftenposten
  4. Her er den mest spennende korona-forskningen akkurat nå

    Bergens Tidende
  5. Hvem er den kinesiske «flaggermuskvinnen»?

    Aftenposten
  6. Nordmenn er blant verdens ivrigste brukere av genetiske selvtester. Dette er svarene de fikk.

    Bergens Tidende

Kommersielt samarbeid: Rabattkoder